Review



td-pm10315 tools pre-stained protein marker (10–315 kda)  (BioTools Co)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    BioTools Co td-pm10315 tools pre-stained protein marker (10–315 kda)
    Td Pm10315 Tools Pre Stained Protein Marker (10–315 Kda), supplied by BioTools Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/td-pm10315+tools+pre-stained+protein+marker/td+pm10315+tools+pre+stained+protein+marker++10+315+kda+/pmc08698394-53-10-17
    Average 90 stars, based on 1 article reviews
    td-pm10315 tools pre-stained protein marker (10–315 kda) - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Western Blot:

    Article Title: GBP5 Repression Suppresses the Metastatic Potential and PD-L1 Expression in Triple-Negative Breast Cancer.
    Article Snippet: RT-PCR experiments were performed by incubating total RNA (5 μg) with M-MLV reverse transcriptase (Invitrogen) and then amplifying cDNA products with Taq-polymerase (Protech) using paired primers (for GBP5, forward-GCCATTACGCAACCTGTAGTTGTG and reverseCATTGTGCAGTAGGTCGATAGCAC; for PD-L1, forward-GCTGCACTTCAGATCACAG ATGTG and reverse-GTGTTGATTCTCAGTGTGCTGGTC; for GAPDH, forward-AGGTCG GAGTCAACGGATTTG and reverse-GTGATGGCATGGACTGTGGTC). .. For Western blot analyses, whole cell lysates obtained from designated experiments and TD-PM10315 TOOLS Pre-Stained Protein Marker (10–315 kDa) (BIOTOOLS Co., Ltd., Taipei, Taiwan) were separated by SDS-PAGE prior to transfer to PVDF membranes. .. Before the incubation with primary antibodies against GBP5 (GeneTex, Hsin-Chu, Taiwan, GTX118635, 1:1000) and GAPDH (AbFrontier, Seoul, Korea, #LF-PA0212, 1:5000) overnight at 4 ◦C, the membranes were immersed in the blocking buffer (5% nonfat milk in TBS containing 0.1% Tween-20) for 2 h at room temperature with a gentle agitation.

    Marker:

    Article Title: GBP5 Repression Suppresses the Metastatic Potential and PD-L1 Expression in Triple-Negative Breast Cancer.
    Article Snippet: RT-PCR experiments were performed by incubating total RNA (5 μg) with M-MLV reverse transcriptase (Invitrogen) and then amplifying cDNA products with Taq-polymerase (Protech) using paired primers (for GBP5, forward-GCCATTACGCAACCTGTAGTTGTG and reverseCATTGTGCAGTAGGTCGATAGCAC; for PD-L1, forward-GCTGCACTTCAGATCACAG ATGTG and reverse-GTGTTGATTCTCAGTGTGCTGGTC; for GAPDH, forward-AGGTCG GAGTCAACGGATTTG and reverse-GTGATGGCATGGACTGTGGTC). .. For Western blot analyses, whole cell lysates obtained from designated experiments and TD-PM10315 TOOLS Pre-Stained Protein Marker (10–315 kDa) (BIOTOOLS Co., Ltd., Taipei, Taiwan) were separated by SDS-PAGE prior to transfer to PVDF membranes. .. Before the incubation with primary antibodies against GBP5 (GeneTex, Hsin-Chu, Taiwan, GTX118635, 1:1000) and GAPDH (AbFrontier, Seoul, Korea, #LF-PA0212, 1:5000) overnight at 4 ◦C, the membranes were immersed in the blocking buffer (5% nonfat milk in TBS containing 0.1% Tween-20) for 2 h at room temperature with a gentle agitation.

    SDS Page:

    Article Title: GBP5 Repression Suppresses the Metastatic Potential and PD-L1 Expression in Triple-Negative Breast Cancer.
    Article Snippet: RT-PCR experiments were performed by incubating total RNA (5 μg) with M-MLV reverse transcriptase (Invitrogen) and then amplifying cDNA products with Taq-polymerase (Protech) using paired primers (for GBP5, forward-GCCATTACGCAACCTGTAGTTGTG and reverseCATTGTGCAGTAGGTCGATAGCAC; for PD-L1, forward-GCTGCACTTCAGATCACAG ATGTG and reverse-GTGTTGATTCTCAGTGTGCTGGTC; for GAPDH, forward-AGGTCG GAGTCAACGGATTTG and reverse-GTGATGGCATGGACTGTGGTC). .. For Western blot analyses, whole cell lysates obtained from designated experiments and TD-PM10315 TOOLS Pre-Stained Protein Marker (10–315 kDa) (BIOTOOLS Co., Ltd., Taipei, Taiwan) were separated by SDS-PAGE prior to transfer to PVDF membranes. .. Before the incubation with primary antibodies against GBP5 (GeneTex, Hsin-Chu, Taiwan, GTX118635, 1:1000) and GAPDH (AbFrontier, Seoul, Korea, #LF-PA0212, 1:5000) overnight at 4 ◦C, the membranes were immersed in the blocking buffer (5% nonfat milk in TBS containing 0.1% Tween-20) for 2 h at room temperature with a gentle agitation.



    Similar Products

    td-pm10315 tools pre-stained protein marker (10–315 kda)  (BioTools Co)
    90
    BioTools Co td-pm10315 tools pre-stained protein marker (10–315 kda)
    Td Pm10315 Tools Pre Stained Protein Marker (10–315 Kda), supplied by BioTools Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/td-pm10315+tools+pre-stained+protein+marker/td+pm10315+tools+pre+stained+protein+marker++10+315+kda+/pmc08698394-53-10-17
    Average 90 stars, based on 1 article reviews
    td-pm10315 tools pre-stained protein marker (10–315 kda) - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    td-pm10315 tools pre-stained protein marker  (BioTools Co)
    90
    BioTools Co td-pm10315 tools pre-stained protein marker
    Td Pm10315 Tools Pre Stained Protein Marker, supplied by BioTools Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/td-pm10315+tools+pre-stained+protein+marker/td+pm10315+tools+pre+stained+protein+marker++10+315+kda+/pm33916322-50-15-19
    Average 90 stars, based on 1 article reviews
    td-pm10315 tools pre-stained protein marker - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results